a). What is the objective of this action? b). Explain how the gene of interest is introduced into a vector.

Question

Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.

a. What is the objective of this action? 

b. Explain how the gene of interest is introduced into a vector. 

c. You are given the DNA shown below. 

5’ ATTTTGAGGATCCGTAATGTCCT 3’ 

3’ TAAAACTCCTAGGCATTACAGGA 5’ 

If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity. 

d. A gene M was introduced into E.coli cloning vector PBR322 at BamH1 site. What will be its impact on the recombinant plamids? Give a possible way by which you could differentiate non recombinant to recombinant plasmids.

OR

GM crops especially Bt crops are known to have higher resistance to pest attacks. To substantiate this an experimental study was conducted in 4 different farmlands growing Bt and non Bt-Cotton crops. The farm lands had the same dimensions, fertility and were under similar climatic conditions. The histogram below shows the usage of pesticides on Bt crops and non-Bt crops in these farm lands.

a. Which of the above 4 farm lands has successfully applied the concepts of Biotechnology to show better management practices and use of agrochemicals? If you had to cultivate, which crop would you prefer (Bt or Non- Bt) and why? 

b. Cotton Bollworms were introduced in another experimental study on the above farm lands where in no pesticide was used. Explain what effect would a Bt and Non Bt crop have on the pest.

Answer 1

a. The two different DNA molecules will have compatible ends to recombine.

b. Restriction enzyme cuts the DNA of the vector and then ligates the gene of interest into the DNA of the vector. 

c. 2 fragments 

5’ ATTTTGAG 3’5’GATCCGTAATGTCCT 3’ 

3’ TAAAACTCCTAG 5’.3’GCATTACAGGA 5’ 

d. BamH1 site will affect tetracycline antibiotic resistance gene, hence the recombinant plasmids will lose tetracycline resistance due to inactivation of the resistance gene. 

Recombinants can be selected from non recombinants by plating into a medium containing tetracycline, as the recombinants will not grow in the medium because the tetracycline resistance gene is cut. 

OR

a. Farm Land II.

Bt crop.

Because the use of pesticides is highly reduced for Bt crop // Decrease of pesticide used is also more significant for Bt crop.

b. In Bt cotton a cry gene has been introduce from bacterium Bacillus thuringiensis (Bt) which causes synthesis of a toxic protein. This protein becomes active in the alkaline gut of bollworm feeding on cotton, punching holes in the lining causing death of the insect.

However; a Non Bt crop will have no effect on the cotton bollworm/ the yield of cotton will decrease / non Bt will succumb to pest attack.